STEP Home Students in Action Portal (SIA) Portal About STEP STEP Alumni About CSTEP CSTEP Alumni Day of Service Calendar of Events
 
Students in Action Portal - STEP Conferences
CSTEP Conference Home
Poster Competition Winners / Abstracts
. Human Services
. Physical Sciences
. Technology
. Natural Sciences
. Social Sciences
 
Oral Presentation Abstracts
. Human Services/Social Sciences
. Natural Sciences
. Technology
 
Workshop Presentation Details
Keynote Speaker Bios & Pics
Conference Schedule
Conference Planning Committee
 
 
STEP Action Channel
STEP Video Snapshot
STEP in the News
STEP Conferences
STEP Student Achievements
 
CSTEP Action Channel
CSTEP Video Snapshot
CSTEP in the News
CSTEP Conferences
CSTEP Student Achievements

Poster Competition Winners / Abstracts - Natural Sciences 1

Natural Sciences 1 - 1st Place
Structural Relationships Affect the Antioxidant and Neuroprotective Efficacies of Ginkgolide Diterpenes and Other Constituents From Ginkgo Biloba Leaf Extracts Against Induced Neurotoxicity in Rat Hippocampal Explants in vitro
By Annalissa Vicencio, Manhattanville College

Certain bioantioxidants, such as Ginkgo biloba, may also have neuroprotective properties, with clinical implications for neurodegenerative diseases. The antioxidant efficacies of the terpenoid and flavonoid fractions have previously been studied on many cell lines, but structural mechanisms have yet to be elucidated. Neuroprotective potency may be dependent on hydroxyl reactivity. Previous studies in our lab have demonstrated that Gin B attenuated verapamil-induced neuronal degeneration in rat hippocampal explants and the flavonoid constituents may play a neuroprotective role in maintaining calcium homeostasis. In the present study, the neuroprotective efficacies of these flavonoid and terpenoid constituents were explored through individual pre-treatment exposures of hippocampal explants followed by a neurotoxic insult by verapamil, a calcium channel blocker, or sodium nitroprusside. Excised 1mm coronal brain slices from 7-9 day old Sprague-Dawley rats were explanted for 24 hours on Millicell inserts in 6-well plates and exposed to either Gin A, B, C, or other bioantioxidants (20µg/ml) for 24 hours and subsequently insulted with verapamil (5mM) or SNP (100uM) for 24 hours. Morphometric data from cresyl violet-stained frozen sections (Vibratome UltraPro 5000) were analyzed with Motic Images Plus 2.0 software. Statistical significance was determined using a one-way ANOVA and subsequent post-hoc Tukey’s and Dunnett’s tests.



Natural Sciences 1 - 2nd Place
Probing the Stability of the Immunologically Active Truncated Human Thioredoxin Via Electrostatics

By Janelle Tertullien, City College of New York (CUNY)

The structure of the inmunologically active truncated human thioredoxin (Trx80) is unknown and high resolution structural studies with standard techniques like Nuclear Magnetic Resonance (NMR) Spectroscopy in solution are unsuitable due to the tendency of Trx80 to aggregate at millimolar concentrations. For that reason, we have chosen as one of many options to improve the solubility of Trx80 via mutagenesis while maintaining its biological activity. Through the use of bioinformatic tools and based on the well-known structure of human thioredoxin, we have evaluated parameters such as hydrophobicity/hydrophilicity, the effect of removing its C-terminal on the stability of the remaining structure, and selected the following mutants of Trx80: Phe77Asp (F77D), Phe79Asp (F79D) and Phe41Arg (F41R) for expression in an E.coli system. It was concluded from our results from the ClusterW alignment that the mutagenesis of the trx80 mutants was successful, and the results from the protein electrophoresis(SDS-Page) showed that the amount of mutant proteins that were expressed is suitable for further studies.


Natural Sciences 1 - 3rd Place
Glycine 3842 of the Mixed Lineage Leukemia Protein is Critical for Proper Folding of the Catalytic SET Domain

By Benny Howard, Syracuse University

The Mixed Lineage Leukemia-1 (MLL) protein is a histone H3 lysine 4 methyltransferase that belongs to a class of proteins that contain an evolutionarily conserved SET domain. MLL positively regulates homeobox (Hox) genes, which are regulators of development in multicellullar organisms. Mutagenesis experiments in the Drosophila homolog of MLL, called Trithorax (trx), have identified a point mutation in the SET domain that changes glycine 3601 to serine (called trxz11) and results in arrested homeotic development and lethality. This glycine is highly conserved across species among SET domain proteins, suggesting that this amino acid plays an important role in the structure and/or function of the SET domain enzymes. To test this hypothesis, we introduced the equivalent mutation (G3842S) into the MLL SET domain and compared the structural and functional properties between the mutant and wild-type enzymes. Using enzyme activity assays, we found that replacement of glycine 3842 with serine abolishes enzymatic activity. Because it was noticed that the G3842S enzyme precipitates more readily in solution, we hypothesized that the loss of enzymatic activity when G3842 is replaced with serine is due to protein misfolding. This was confirmed by light scattering and by analytical ultracentrifugation. It was found that the mutant protein more readily forms high molecular weight aggregates and is polydisperse. In addition, velocity sedimentation studies reveal that the mutant protein contains a larger frictional coefficient, consistent with an altered conformation that experiences more viscous drag. These data are consistent with a model in which a highly conserved glycine is critical for the proper folding and activity of SET domain lysine methyltransferases.


Natural Sciences 2 - 1st Place
A Single Nucleotide Polymorphism in the Human OR3A1 Olfactory Rreceptor Gene Discriminates Between an Intact and Pseudogene Allele

By Lindita Ismaili, Kingsborough Community College

In mammals, initial detection of chemical odorants occurs when an odorant interacts with a specific olfactory receptor (OR) in the nasal cavity. Although olfactory receptors are known to bind odorants, the specificity of ligands has not been determined for most receptors. The human olfactory receptors are encoded by 1000-1400 genes. In mice, 20% of the OR genes are pseudogenes, but surprisingly, over 60% of the human OR genes are pseudogenes or are segregating between intact and pseudogene alleles. OR3A1 is a segregating human OR gene with an intact allele frequency of 55% and a pseudogene allele frequency of 45%. We have developed a PCR-based assay that detects a single nucleotide polymorphism which discriminates between the intact and pseudogene alleles of the OR3A1 gene. We have used this assay to determine the genotype of individuals and we plan to test these individuals for their discrimination of different odorants. This information can be used to correlate odorant discrimination with functionality of the OR3A1 receptor and a similar assay could be used for determination of ligand specificity of other olfactory receptors. L. Ismaili is a student participant in the Collegiate Science and Technology Program of the NY State Education Department, grant number 0516051091.


Natural Sciences 2 - 2nd Place
Elucidation of the Oxidative Stress Response in Drosophila Melanogaster Adult Males

By Pedro Granados, LaGuardia Community College

Oxidative stress, which results from increased production of free radicals and/or decreased levels of antioxidants, has deleterious effects on male reproductive biology, and can lead to infertility. Peroxiredoxin 3 (Prx3) is a mitochondrial thioredoxin-dependent peroxidase that neutralizes excess peroxides; Prx3 plays a cytoprotective role. We investigated whether Prx3 plays a role in the oxidative stress response in male flies. Adult transgenic male flies expressing ?-tubulin-GFP were dry starved for 6 hours, and exposed to filter paper soaked in 5% sucrose containing 0% (control), 0.3%, or 0.9% hydrogen peroxide (H2O2). After 48h, total RNA was extracted from whole flies and used for Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) analyses. Prx3 mRNA levels increased 2-fold in males treated for 48h with 0.3% and 0.9% H2O2. We next performed an initial screen to determine whether H2O2 treatment affects the testis. Phase-contrast and fluorescent microscopy were performed on testicular squashes. H2O2 treatment for 48h appears to adversely affect the cells at the apical end of the fly testis, as indicated by decreased??-tubulin-GFP signal in testicular squashes. In summary, 48h exposure to 0.3% and 0.9% H2O2 results in increased Prx3 mRNA levels in males and decreased ?-tubulin-GFP in the apical cells of the testis.


Natural Sciences 2 - 3rd Place
Synthesis of Pyridinium and Imidazolium Ionic Liquids for Toxicity Studies

By Xing Li, Queensborough Community College, CUNY

Ionic liquids (ILs) are salts with melting points below 100 °C. Attention has been drawn to the Ils lately because of their relative non-volatility, non-flammability, wide liquid range, and high conductivity. These properties make ILs good candidates as potential green solvent alternatives to volatile organic solvents. We have successfully prepared a series of halide salts based on 1-methylimidazole and pyridine. 1-methylimidazole and pyridine were reacted with alkyl halides of various chain lengths to produce the corresponding quaternary ammonium halide salts. The salts were converted to ionic liquids bearing the phosphate and bis(trifluoromethylsulfonyl)imide anions. Degree of color and reaction temperature was used to determine purity level. The structures of the salts were confirmed using H-1 and C-13 Nuclear Magnetic Resonance spectroscopy (NMR). The grades of purity were detected by using UV- Vis spectroscopy and fluorescence. The liquids were screened for their toxicity to a variety of microorganisms. Preliminary results indicate that bacterial growth inhibition caused by ILs is dependent on concentration, alkyl chain length and bacterial strain. It was also observed that alkyl chain length affects mycelial growth. This is part of a larger collaborative research project where other similar series of ionic liquids will be prepared and tested.


Natural Sciences 3 - 1st Place
Interleukin-10 Inhibits Dendritic Cell (DC) Activity by Inducing Apoptosis of Precursors Newly Committed to DC Growth

By Jean Bernard Lubin, SUNY Farmingdale

Dendritic cells are antigen presenting cells that regulate adaptive (antigen-driven) immunity. Monocyte-macrophages, while sharing functions with DCs, promote innate (nonspecific) immunity. DCs and mono-macrophages share a common precursor. Proteins known as cytokines regulate the growth of DCs from these precursors. Interleukin-10 (IL-10) is a cytokine that suppresses DC growth. However, molecular mechanisms underlying this suppression remain poorly characterized. We hypothesized that IL-10 inhibits DC activity by initiating an apoptotic (programmed cell death) schedule at the onset of DC growth from monocyte/DC precursors. To test our hypothesis, peripheral blood precursors were cultured with cytokines sustaining DC growth (GM-CSF/IL-4) in the absence/presence of IL-10. Temporal analyses of Annexin V binding and cell morphology verified that IL-10 induces apoptosis within 48 hrs. In order to identify IL-10 targeted cells, we designed a flow cytometry-based strategy allowing simultaneous evaluation of apoptosis and cell surface phenotype (immunofluorescence analysis). Our results substantiate that IL-10 mediates apoptosis of monocyte/DC precursors while sparing monocyte-macrophage like cells. Surviving cells exhibited exceptionally high phagocytic ability but lacked the capacity to stimulate naïve T cells (a hallmark function of DCs). Thus, IL-10 regulates DC activity by killing monocyte/DC precursors upon commitment to DC growth while enhancing monocyte-macrophage survival and innate immunity.


Natural Sciences 3 - 2nd Place
The Role of Stat3 in Breast Tumorigenesis

By Jamie-Lee Foote, City College of New York

Signal transducer and activator of transcription 3 (Stat3) is a transcription factor that is over-activated in approximately 50% of breast cancers. Studies suggest that primary breast cancers with high levels of activated (phosphorylated) Stat3 respond poorly to chemotherapy. Studies also show that cancer-derived cell lines that contain constitutively activated Stat3 undergo growth arrest when the protein is abrogated. However, Stat3’s definitive role in breast cancer tumorigenesis remains elusive. Our aim is to determine whether expression of an activated form of Stat3 (Stat3C) in the tissue of a breast tumor mouse model can lead to enhance tumorigenesis in vivo under the oncogenic background of polyoma virus middle T antigen (PyMT). Our preliminary studies using tumors derived from MMTV driven PyMT mouse lines indicate high levels of activated Stat3 in tumors. Therefore, in order to achieve our goal, an inducible system was created. MMTV-reverse tetracycline-dependent transactivator rtTA (MTB) transgenic animals were crossed with a Tet-O-Stat3C line resulting in doxycycline-inducible Stat3C expression. Finally, to generate Stat3C/MTB/PyMT animals, MMTV-PyMT transgenic mice were crossed with the MMTV-reverse/Tet-O-Stat3C double transgenic mice. Tumorigenic analyses are performed at different time points after doxycycline feeding. Techniques employed for these analyses include western blot, RT-PCR and breast tissue whole mounts.


Natural Sciences 3 - 3rd Place
Is There a Cross Talk Between Toll/NF-?B & JAK/STAT Signaling in Hematopoiesis?

By Jeffrey Uribe, City College of The City University of New York

Drosophila is a model for studying hematopoiesis, regulated by the Toll and JAK/STAT pathways. Loss-of-function mutations in Ubc9, a negative regulator of the Toll pathway, result in over-proliferation and differentiation of immune-active blood cells and the formation of tumors. The same phenotype occurs in larvae carrying gain-of-function mutations in the fly Janus kinase gene, Hopscotch. The goal of my project is to determine if constitutive blood cell differentiation observed in Ubc9 mutants is mediated by the JAK/STAT pathway. We are using a transgenic GFP reporter of STAT activity (10X STAT-GFP) to examine which immune cells in Ubc9- are GFP positive. JAKgof animals are used as a reference to study STAT activation. Preliminary results show upregulation of JAK/STAT signaling in specific cells within the anterior lobes of lymph glands of both Ubc9 and JAKgof mutants relative to control animals, although the expression pattern is different. Thus, STAT activity is differentially activated in Toll and JAK/STAT pathway mutants. We will now examine if increased 10X STAT-GFP expression in Ubc9- background is dependent on JAK/STAT function. These experiments will allow us to delineate the lymph gland cells in which cross-talk is occurring and confirm that STAT pathway is downstream of the Toll pathway.


Natural Sciences 4 - 1st Place
Identification of Novel CTX-M Extended Spectrum Beta-Lactamases in Escherichia coli Clinical Isolates

By Ronald L. McHenry, Jr., SUNY College at Old Westbury

This study aims to identify a class of clandestine beta-lactamases in Escherichia coli which are phenotypically resistant to ceftazidime, a third generation cephalosporin. Thirty-one randomly selected single patient clinical specimens of Escherichia coli isolated from sources that included urine, blood and sputum were obtained from the Infectious Disease Research Laboratory at New York Hospital Queens. Minimal inhibitory concentration (MIC) experiments to determine the efficacy of antibiotics were performed using E-test methodology. For DNA preparation, isolates were grown using established protocols that included cell lysis followed by ethanol precipitation. Polymerase chain reactions (PCR) were done using primers specific for two classes of beta-lactamases: CTX-M; Forward-(GCTTTATGCGCAGACGAGTG); CTX-M: Reverse- (TGATTGGTGGTGCCGTAGTC) and KPC-2; Forward-(ATGTCACTGTATCGCCGTCT) Reverse-(TTTTCAGAGCCTTACTGCCC). Amplified products were visualized by agarose gel electrophoresis. PCR results of Escherichia coli isolates indicated that 16/31 (52%) was positive using KPC-2 primers and 14/31 were (48%) positive using CTX-M primers. Eleven isolates contained both CTX-M and KPC-2 enzymes by PCR. CTX-M beta-lactamases may not be detected in the clinical microbiology laboratory because of their hydrolytic activity towards specific third generation cephalosporins.
Supported by NIGMS-MARC GM08722


Natural Sciences 4 - 2nd Place
Does High Sugar Intake Lead to Obesity?

By Emily Kyrillou, Barnard College

Over the last 30 years, the prevalence of obesity has increased dramatically in the United States. Several investigators have shown that the increased obesity incidence is associated with increased consumption of sugar-sweetened beverages. I used mice as a model system to determine whether increased intake of sugar solutions necessarily leads to obesity. To this end, I examined the effects of ad libitum access to sucrose (10% and 34% solution) or fructose (10% and 34% solution) on adipogenesis in four strains of mice (129P3, C57BL/6, FVBN and AKR). All mice were given ad libitum access to chow diet and water during the exposure period. I observed large strain differences in (a) daily intake of the sugar solutions, and (b) weight gain over the 40-day experiment. However, there was no clear relationship between daily intake and weight gain across the strains. For instance, the strain that consumed the most sugar solution (FVB) failed to gain any weight, whereas the strain the consumed the least sugar solution (AKR) gained the most weight. Such results point to a complex relationship between sugar intake and obesity.


Natural Sciences 4 - 3rd Place – Tied
Prevalence of Enterotoxins (SEs) in Staphylococcus Aureus (SA) Isolates From the Bronx, NY

By Natalie Robiou, Fordham University

The objective of our research was to determine the prevalence of SEs in wound and blood SA isolates in 100 blood and 109 wound SA isolates that were sequentially collected from four community hospitals in the Bronx. Comparable percentage of MSSA and MRSA strains were found in wound and blood isolates. Presence of 10 SEs (A-E, G, I, O, Q, TSST-1) was determined by PCR. SE genes were frequently detected and only 14.4% of SA isolates did not contain SE genes. The prevalence of individual SE-genes was variable and as follows: SEI>SEG>SED>SEO>PVL>SEC>SEQ>SEB>TSST>SEA>SEE. Combinations of SEs were common as phages, pathogenicity islands and plasmids often encode for more than one SE. The egc cluster (seg-sei-seo) was the most combination. Of note is that SE genes were less common in SA strains that contained the Panton-Valentine Leucocidin (PVL+) gene. The 38 SA PVL+ isolates were further typed using RFLP. Nineteen of 23 MRSA were clone USA300, 2 USA400 and 2 other clones, while 9 different clones were identified among the PVL+ MSSA isolates. In summary our data demonstrated that SE genes are abundant in clinical SA isolates in the Bronx. PVL + isolates are much more common in wound isolates and carry less or no SE genes.


Natural Sciences 4 - 3rd Place – Tied
Analysis of Lipids and Fatty Acids in NMU Rat Mammary Tumor Cells After Treatment With Dietary Fatty Acids

By Aileen Fernandez, SUNY Purchase

Research has shown that cancer cell proliferation increases with exposure to omega-6 fatty acids, e.g., linoleic acid (LA), and decreases the exposure to omega-3 fatty acids, e.g., docosahexaenoic acid (DHA). In the present study, NMU cells were cultured with 10% serum, or 1% serum in the presence or absence of DHA or LA for 3 days. Lipids were isolated and separated by thin layer chromatography (TLC). Quantitation of the various lipids were done using scanning densitometry. Fatty acids from the various lipid fractions were examined using Gas-Liquid Chromotography/Mass Spectrometry (GC/MS). Analysis of the lipid patterns revealed that the dominant species were phospholipids and cholesterol. Cholesterol esters were present in smaller amounts. Fatty acid treatment of the cells resulted in no major changes in the phospholipids and cholesterol esters. Differences were observed in cholesterol levels with the various treatments. For example, cholesterol levels were lower in LA and DHA treated cells as opposed to cells treated with 1% and 10% serum. Phospholipids found in cells after 3 days were phosphatidylserine (PS), phosphatidylinositol (PI), and phosphatidylethanolamine (PE). Phosphatidylcholine (PC) was present in smaller amounts. In cells retreated with fatty acids before analysis, PC levels rose, while levels of PS and PI dropped. Further analysis using this model will help us to understand the role of exogenous lipids in normal and cancer cell proliferation. Supported in part by Grants: NIH 62012-05 and NSF Due 0524965.



Natural Sciences 5 - 1st Place
Mus Musculus Atp8a1 and ATPase 1B and Plasma Membrane Phosphatidylserine Translocation in Neuronal Cells

By Kelly Levano, College of Staten Island

Flippases, also known as aminophospholipid translocases (APLTs), sequester phosphatidylserine (PS) to the inner leaflet of the plasma membrane. Biochemical studies have shown that APLT is an ATP-dependent, P-type Mg2+-ATPase activity. In our quest to elucidate the protein or proteins responsible for the plasma membrane APLT activity in neuronal cells, we have been studying the roles of two P-type ATPases, Atp8a1 and ATPase IB, in the translocation of the fluorescent PS analogue, NBD-PS. Transient overexpression of Atp8a1 in the N18 neuroblastoma cells causes a 2.5-fold increase in plasma membrane APLT activity, but similar overexpression of ATPase 1B does not elicit an increase in APLT activity. In our earlier studies, similar high levels of overexpression of Atp8a1 in the hippocampal neuron-derived HN2 cells yielded elevated, plasma membrane APLT activity. However, relatively lower levels of stable overexpression of Atp8a1 in the HN2 cells does not cause an increase in the plasma membrane APLT activity but clearly alters the time course NBD-PS translocation. PS internalization, which is an important property of healthy cells, is lost in apoptotic cells causing PS externalization and phagocyte recognition of these cells by PS receptor-containing mast cells. Using siRNA and antisense mediated suppression of both Atp8a1 and ATPase 1B followed by rigorous kinetic analysis, we will test the hypothesis that Atp8a1 and/or ATPase 1B contribute toward or modify plasma membrane APLT activity in neuronal cells.
Supported by NIH CA77803-03; LS-AMP and MAGNET-AGEP.


Natural Sciences 5 - 2nd Place
Depurination of RNA by Pokeweed Antiviral Protein (PAP): Fluorometric Determination of released Adenine

By Ana Sanchez, John Jay College of Criminal Justice-CUNY

Ribosome inactivating proteins (RIPs) are naturally occurring cytotoxic agents found in numerous plant, fungi, and bacterial species. They have been recognized as important antiviral agents. Pokeweed Antiviral Protein (PAP) is an RIP that inhibits protein synthesis by depurination of the conserved sarcin/ricin loop found on the large ribosomal Ribonucleic Acid (RNA). Additionally, PAP has been found to bind and depurinate capped mRNA. This project plans to measure the level of RNA depurination by fluorometric assay of adenine released by PAP.

Ribosomal RNA (rRNA) will be incubated in a suitable temperature and pH environment, having PAP present and absent. After incubation, the RNA mixture is treated with cold ethanol, and the ethanol-soluble fraction undergoes centrifugation. Free adenine present in the recovered portion is treated and converted to its derivative (ethenoadenine). Direct measurements of the derivative will be performed by monitoring emission wavelength (400nm) using an excitation wavelength of 280nm.

The amount of adenine released from rRNA will be determined by the difference between fluorescence readings of PAP-treated and non PAP-treated RNA. In addition, the amount of adenine released will be quantitated by comparison with free adenine controls.


Natural Sciences 5 - 3rd Place
Chiral Recognition of a Fish Pheromone by CD-Sensitive Dimeric Zinc Porphyrin Host

By Ekaterina Chadwick, John Jay College of Criminal Justice-CUNY

The following is the determination of the absolute configuration of 17, 20 ??-dihydroxy-4-pregnen-3-one, a fish pheromone, by use of the Zinc-porphyrin host-guest CD exciton chirality. The protocol relies on a host-guest complexation mechanism: the chiral substrate is derivatized to give a bifunctional conjugate ("guest") that form a complex with a dimeric zinc porphyrin host that acts as a "receptor". The two porphyrins in the complex adopt a preferred helicity related to the substrate’s absolute configuration. The absolute configuration of the substrate is confirmed by molecular modeling studies.

 

 

Site powered & created and Technology Users Interface, Inc.
All content therein on STEPforLeaders.org is organized by NYS STEP & CSTEP Programs. Copyright © 2009. All Rights Reserved.
Find a STEP or CSTEP Program.